A BIODIESEL, A FUEL BLEND COMPRISING THE BIODIESEL, AND METHOD OF SYNTHESIS THEREOF

Abstract

A biodiesel, a fuel blend comprising the biodiesel, and method of synthesis thereof, are disclosed. Said biodiesel broadly comprises: Calophyllum inophyllum seed oil, Enterobacter cloacae bacterial strain, loofah sponge, and methanol. Said fuel blend broadly comprises: a petroleum-based diesel and said biodiesel, in a ratio of about 4:1. The disclosed biodiesel, fuel blend, and method of synthesis, offer at least the following synergistic advantages and effects: facilitate conversion of non-edible oil into value-added products; offer a high conversion of fatty acid methyl ester (about 90.2%); produce lower emissions when compared with those of conventional fuels; produce lower smoke opacities (or produce comparable smoke opacities), when compared with those of conventional fuels; and/or do not require any modifications, to be made to diesel engines.

Specification

Description:TITLE OF THE INVENTION: A BIODIESEL, A FUEL BLEND COMPRISING THE BIODIESEL, AND METHOD OF SYNTHESIS THEREOF
FIELD OF THE INVENTION
The present disclosure is generally related to fuels. Particularly, the present disclosure is related to biofuels. More particularly, the present disclosure is related to: a biodiesel; a fuel blend comprising the biodiesel; and method of synthesis thereof.
BACKGROUND OF THE INVENTION
Rising energy demands, finite fossil resources, and the need to minimise carbon dioxide emissions have led to biodiesel gaining great significance. Food crops are used to synthesise first-generation biofuels. However, while first-generation biofuel technologies are beneficial, they can't synthesise enough biofuels, over a certain point, without compromising food supplies and biodiversity.
The difficulties accompanying first-generation biofuels may be addressed by second-generation biofuels. Transesterification has been recognised as a viable method for second-generation biodiesel synthesis. However, there are still several issues that must be resolved to enhance effectiveness of the second-generation biofuels. The issues include, but are not limited to: creating effective techniques for separation and purification of biodiesel; catalyst deactivation and unwanted reactions; low selectivity; low yield; and/or the like.
There is, therefore, a need in the art, for: a biodiesel; a fuel blend comprising the biodiesel; and method of synthesis thereof, which overcome the aforementioned drawbacks and shortcomings.
SUMMARY OF THE INVENTION
A biodiesel, a fuel blend comprising the biodiesel, and a method of synthesising the same, are disclosed. Said method broadly comprises the following steps:
Cultured Enterobacter cloacae cells are immobilised on a loofah sponge matrix by immersing said loofah sponge matrix in Zobell marine broth, to obtain Enterobacter cloacae cells that are immobilised on the loofah sponge matrix.
The immobilised Enterobacter cloacae cells are mixed with Calophyllum inophyllum oil and water, with ratio of said Calophyllum inophyllum oil to said water being 12.5:1.
Transesterification is performed with methanol at 37°C for 72 hours, with: ratio of said methanol to said oil being 6:1; 50% of said methanol being added after 24 hours; and remaining 50% of said methanol being added after 48 hours.
The disclosed biodiesel, fuel blend, and method of synthesis, offer at least the following synergistic advantages and effects: facilitate conversion of non-edible oil into value-added products; offer a high conversion of fatty acid methyl ester (about 90.2%); produce lower emissions when compared with those of conventional fuels; produce lower smoke opacities (or produce comparable smoke opacities), when compared with those of conventional fuels; and/or do not require any modifications, to be made to diesel engines.
BRIEF DESCRIPTION OF THE DRAWINGS
Figure 1 and Figure 2 illustrate a marine bacterial strain BF2 grown in Zobell marine agar, and the strain exhibiting lipase activity in tributyrin agar, respectively, in accordance with an embodiment of the present disclosure;
Figure 3A and Figure 3B illustrate results of biofilm assays after 48 hours and after 72 hours, respectively, in accordance with an embodiment of the present disclosure;
Figure 4A and Figure 4B illustrate results of scanning electron microscopy images of untreated and immobilised matrices, in accordance with an embodiment of the present disclosure;
Figure 5A and Figure 5B illustrate RSM experimental data with respect to methanol to oil ratio and catalyst (wt. %) on FAME yield, in accordance with an embodiment of the present disclosure;
Figure 5C and Figure 5D illustrate RSM experimental data with respect to methanol to oil ratio and water content on FAME yield, in accordance with an embodiment of the present disclosure;
Figure 5E and Figure 5F illustrate RSM experimental data with respect to catalyst (wt. %) and water content on FAME yield, in accordance with an embodiment of the present disclosure;
Figure 6 illustrates results obtained, from analyses of brake-specific fuel consumption, in accordance with an embodiment of the present disclosure;
Figure 7 illustrates results obtained, from analyses of brake thermal efficiencies, in accordance with an embodiment of the present disclosure;
Figure 8 illustrates results obtained, from analyses of carbon monoxide emissions, through standard testing methodologies, in accordance with an embodiment of the present disclosure;
Figure 9 illustrates results obtained, from analyses of hydrocarbon emissions, through standard testing methodologies, in accordance with an embodiment of the present disclosure;
Figure 10 illustrates results obtained, from analyses of NOx emissions, through standard testing methodologies, in accordance with various embodiments of the present disclosure; and
Figure 11 illustrates results obtained, from analyses of smoke opacity, through standard testing methodologies, in accordance with an embodiment of the present disclosure.
DETAILED DESCRIPTION OF THE INVENTION
Throughout this specification, the use of the words "comprise" and "include", and variations, such as "comprises", "comprising", "includes", and "including", may imply the inclusion of an element (or elements) not specifically recited. Further, the disclosed embodiments may be embodied, in various other forms, as well.
Throughout this specification, the use of the word "synthesis", and its variations, is to be construed as: "produce; manufacture; and/or the like".
Throughout this specification, where applicable, the use of the word "biodiesel" is to be construed as: "biodiesel that is synthesised from Calophyllum inophyllum seed oil with a marine lipolytic bacteria (taxonomically identified as a salt-tolerant Enterobacter cloacae strain) as a biocatalyst (catalyst) and loofah sponge as a matrix".
Throughout this specification, the use of the phrase "fuel blend" is to be construed as: "fuel broadly comprising biodiesel, from Calophyllum inophyllum seed oil, which is blended, with a conventional fuel".
Throughout this specification, the use of the phrase "marine bacterial strain BF2" and the word "strain" is to be construed as: "a marine lipolytic bacteria (taxonomically identified as a salt-tolerant Enterobacter cloacae strain)".
Throughout this specification, the use of the word "matrix" is to be construed as: "loofah sponge".
Throughout this specification, the use of the acronym "CFU" is to be construed as: "Colony Forming Unit".
Throughout this specification, the use of the acronym "PCR" is to be construed as: "Polymerase Chain Reaction".
Throughout this specification, the use of the acronym "RPM" is to be construed as: "Revolutions Per Minute".
Throughout this specification, the use of the acronym "SEM" is to be construed as: "Scanning Electron Microscope".
Throughout this specification, the use of the acronym "RSM" is to be construed as: "Response Surface Methodology".
Throughout this specification, the use of the acronym "RMSE" is to be construed as: "Root Mean Square Error".
Throughout this specification, the use of the acronym "ANOVA" is to be construed as: "Analysis of Variance".
Throughout this specification, the use of the acronym "DF" is to be construed as: "Degrees of Freedom".
Throughout this specification, the use of the acronym "Adj SS" is to be construed as: "Adjusted Sum of Squares".
Throughout this specification, the use of the acronym "Adj MS" is to be construed as: "Adjusted Mean Squares".
Throughout this specification, the use of the acronym "FAME" is to be construed as: "Fatty Acid Methyl Ester".
Throughout this specification, the use of the acronym "BD10" is to be construed as: "a fuel blend broadly comprising about 10% by volume of biodiesel synthesised from Calophyllum inophyllum seed oil and about 90% petroleum-based diesel".
Throughout this specification, the use of the acronym "BD20" is to be construed as: "a fuel blend broadly comprising about 20% by volume of biodiesel synthesised from Calophyllum inophyllum seed oil and about 80% petroleum-based diesel".
Throughout this specification, the use of the acronym "PBD" is to be construed as: "Petroleum-Based Diesel".
Throughout this specification, the use of the acronym "BD" is to be construed as: "Biodiesel synthesised from Calophyllum inophyllum seed oil".
Throughout this specification, the use of the acronym "EGT" is to be construed as: "Exhaust Gas Temperature".
Throughout this specification, the use of the acronym "BTE" is to be construed as: "Brake Thermal Efficiency".
Throughout this specification, the use of the acronym "BSFC" is to be construed as: "Brake-Specific Fuel Consumption".
Throughout this specification, the use of the acronym "CO" is to be construed as: "Carbon Monoxide".
Throughout this specification, the use of the acronym "HC" is to be construed as: "Hydrocarbon".
Throughout this specification, the use of the acronym "NOx" is to be construed as: "a by-product of reactions involving nitrogen oxides".
Throughout this specification, the use of the acronym "SO" is to be construed as: "Smoke Opacity".
Throughout this specification, the disclosure of a range is to be construed as being inclusive of: the lower limit of the range; and the upper limit of the range.
Throughout this specification, the words "the" and "said" are used interchangeably.
Throughout this specification, the words "loofah" and "luffa" are used interchangeably.
Also, it is to be noted that embodiments may be described as a method. Although the operations, in a method, are described as a sequential process, many of the operations may be performed in parallel, concurrently, or simultaneously. In addition, the order of the operations may be re-arranged. A method may be terminated, when its operations are completed, but may also have additional steps.
A biodiesel, a fuel blend comprising the biodiesel, and method of synthesising the same, are disclosed. The disclosed biodiesel and fuel blend were synthesised and tested, as follows:
Sample Collections
Calophyllum inophyllum seeds were collected from Irumbai, Tamil Nadu, India. About 200 g of seeds was used for extraction of oil using a hydraulic oil expeller machine to obtain an oil yield of about 62% (i.e., about 124 g of oil). About 100 g of matrix was procured from local markets in Thanjavur, Tamil Nadu, India. Tributrin agar and Zobell marine broth were procured from HiMedia Laboratories Private Limited, India.
Marine water was collected from the Bay of Bengal, Adirampattinam, Thanjavur, India. A steel plate was immersed in the collected marine water for about 2 weeks to obtain biofilms. Said biofilm was cultured in Zobell marine agar to isolate a microbial strain, denoted as BF2 (later identified as Enterobacter cloacae).
Screening
As illustrated, in Figure 1, the marine bacterial strain BF2 was cultured on Zobell marine agar at about 27°C for about 48 hours.
The presence of lipolytic activity was determined using a tributyrin plate test. Colonies of the strain were grown on tributyrin agar and incubated for about 24 hours. As illustrated, in Figure 2, the zone of clearance indicated that the strain can effectively break down lipids.
Genomic DNA Extraction and Molecular Identification
Genomic DNA of overnight bacterial cultures was isolated, as published by Nithyanand and Pandian (2009). This was followed by, PCR amplification, under the following conditions: first 3 minutes of denaturation at about 95℃; about 40 cycles: about 1 minute of denaturation at about 95℃; about 1 minute of annealing at about 55℃; about 2 minutes extension at about 72℃; and a final 5 minutes extension step at about 72℃. The PCR primers were as follows:
Forward Primer: 5' AGAGTTTGATCCTGGCTCAG 3'; and
Reverse Primer: 3' ACGGCTACCTTGTTACGACTT 5'

Running the amplified sequence on an agarose gel (about 1%) in Tris-acetate-EDTA (about 1%) allowed for confirmation of 16S rRNA gene amplification.
Top of Form
Bottom of Form
The sequence was compared using the BLAST program, resulting in the identification of the strain as Enterobacter cloacae (GenBank Accession No.: PP266699), based on comparisons to the strains listed in the table below.
Gene Accession No. Closely Related Strain in GenBank Percentage Identity
KY078803
Enterobacter cloacae 99.70%
JX188069
Enterobacter cloacae 99.70%
HQ154578
Enterobacter cloacae 99.70%
KY672863
Enterobacter sp. 99.70%
KY672862.
Enterobacter sp. 99.70%
KX953296
Enterobacter sp. 99.70%
KX953295
Enterobacter sp. 99.70%
MN294584
Enterobacter cloacae 99.70%
KY287934
Enterobacter cloacae 99.70%
OP962789
Enterobacter cloacae 99.70%
OP381499
Enterobacter cloacae 99.70%
KX168041
Enterobacter sp. 99.56%
Biofilm Forming Assays
Glass slides were cut and inserted into wells containing Zobell broth. The cultured BF2 cells were then inoculated into these wells. After allowing the cells to grow, planktonic bacteria were removed by washing the wells.
To evaluate biofilm development, the cells were added to three separate wells and incubated for different durations: about 24 hours, about 48 hours, and about 72 hours, in 1st well, 2nd well, and 3rd well, respectively. The biofilm formation was visualised by staining the cells still attached to the wells with crystal violet dye.
Subsequently, the slides were examined under a microscope. As illustrated, in Figure 3A and Figure 3B, the biofilms developed in the 2nd well and the 3rd well. As illustrated, in Figure 3B, more biofilms developed after about 72 hours.
Bacterial Cell Immobilisation on the Matrix
The procured matrices were cut into small pieces (about 1cm x 1 cm), followed by submerging in Zobell Marine Broth and then autoclaving at about 121°C under high pressure. Dry weight of the matrices was measured as about 100 g, and dry weight of single matrix was about 0.458 g.
About 20 matrices were immersed in about 100 mL of Zobell marine broth, and about 3% (v/v) of inoculum was used for growth of the bacterial strain (BF2), in about 500 mL Erlenmeyer flask. The cultures were incubated on a rotary shaker at about 150 rpm and maintained at about 37°C for a duration of about 48 hours to obtain bacterial immobilised matrices (also referred to as "immobilised matrices").
Following the immobilisation, the dry weight of single matrix was about 0.972 g, showing that about 0.514 g of bacterial cells were successfully entrapped within the matrices. This demonstrated the efficacy of the loofah sponge as a medium for cell immobilisation.
The bacterial immobilised matrices were subjected to SEM to verify the immobilisation of bacterial cells. As illustrated, in Figure 4A and Figure 4B, analyses were performed for fresh matrix and immobilised matrix. As illustrated, in Figure 4B, a rod shape confirmed the presence of bacteria in the immobilised matrix.
Methanol Tolerance Assay
Methanol tolerance assays were performed to determine molar ratio of methanol: oil for transesterification. The assays were performed by rising overnight cultures of a positive control and the BF2 samples with varying ratios of methanol to Zobell marine broth, from about 5:1 to about 9:1. The samples were then serially diluted from a dilution factor of about 101 to about 1010 and then spot-plated on an agar plate to count the CFU/mL. The colony-forming units were calculated by the formula below,
CFU⁄mL=((Number of Colonies×Dilution Factor))⁄(Volume of Culture Plate)
The results are shown in the table below.
Sample Dilution Factor CFU/mL
Control - Too numerous to count
6:1 104 1.6*107
7:1 104 1.4*107
8:1 104 0.8*107
9:1 102 2.4*105
Response Surface Methodology Analyses
For RSM experiments, Central Composite Design (CCD) was implemented. About 20 experiments were carried out, in order to estimate the potential, for biodiesel production. Observed biodiesel yield was established and incorporated into the data being examined using the equation below,
Biodiesel yield (%)=35.43+4.44× C_(M/R)-0.79 ×C_C+8.42× C_W-0.36〖×C〗_(M⁄R) 〖×C〗_(M⁄R)+0.031 ×C_C×C_C-0.45×C_W×C_W+0.023〖×C〗_(M⁄R)×C_C+0.043 〖×C〗_(M⁄R)×C_W-0.37×C_C ×C_W
The below table shows the results of actual CCD readings combined with the biodiesel produced by whole-cell biocatalyst and its observed and anticipated values,
Std Order Run Order Pt Type Blocks Methanol/
Oil
(CM/R) Catalyst Weight
(CC) Water Content
(CW) Biodiesel Yield
Exp Predicted
1 1 1 1 3 10 4 66.5 66.9
2 2 1 1 9 10 4 70.4 70.2
3 3 1 1 3 30 4 73.7 73.9
4 4 1 1 9 30 4 79.0 79.9
5 5 1 1 3 10 12 75.8 75.1
6 6 1 1 9 10 12 80.5 80.4
7 7 1 1 3 30 12 75.9 76.2
8 8 1 1 9 30 12 84.6 84.3
9 9 -1 1 3 20 8 77.4 77.1
10 10 -1 1 9 20 8 83.1 82.8
11 11 -1 1 6 10 8 82.9 83.5
12 12 -1 1 6 30 8 90.2 89.0
13 13 -1 1 6 20 4 74.2 72.9
14 14 -1 1 6 20 12 78.4 79.1
15 15 0 1 6 20 8 82.1 83.2
16 16 0 1 6 20 8 83.7 83.2
17 17 0 1 6 20 8 81.8 83.2
18 18 0 1 6 20 8 82.4 83.2
19 19 0 1 6 20 8 84.2 83.2
20 20 0 1 6 20 8 83.5 83.2
Statistical analyses were performed through the ANOVA model. The values obtained for each derivative are shown in the table below.
Source DF Adj SS Adj MS F-Value P-Value
Model 9 578.341 64.260 56.49 0.000
Linear 3 253.418 84.473 74.26 0.000
Methanol/oil (Molar ratio) CM/R 1 80.713 80.713 70.95 0.000
Catalyst weight (CC) 1 73.984 73.984 65.04 0.000
Water content (CW) 1 98.722 98.722 86.78 0.000
Square 3 301.777 100.592 88.43 0.000
CM/R × CM/R 1 28.384 28.384 24.95 0.001
CC × CC 1 25.957 25.957 22.82 0.001
CW × CW 1 140.891 140.891 123.85 0.000
2-Way Interaction 3 23.146 7.715 6.78 0.009
CM/R × CC 1 3.659 3.659 3.22 0.103
CM/R × CC 1 2.112 2.112 1.86 0.203
CC × CW 1 17.376 17.376 15.27 0.003
Error 10 11.376 1.138
Lack-of-Fit 5 6.606 1.321 1.39 0.365
Pure Error 5 4.770 0.954
Total 19 589.717
As illustrated, in Figure 5A and Figure 5B, biodiesel yield reached a maximum of up to about 90.2% at a methanol to oil ratio of about 6:1 and a catalyst weight percentage of about 30%, after which a decrease in yield was observed.
As illustrated, in Figure 5C and Figure 5D, biodiesel yield reached a maximum of up to about 90.2% at the methanol to oil ratio of about 6:1 and a water content weight percentage of about 8%.
As illustrated, in Figure 5E and Figure 5F, maximum biodiesel yield of about 90.2% was obtained, at the catalyst weight percentage of about 30% and the water content weight percentage of about 8%.
Transesterification of Calophyllum inophyllum Oil
About 58 matrices containing about 30 g (about 30% by oil) of the immobilised cells was introduced to a flask containing about 100 g of the oil and about 8 mL water (8% by oil). Ratio of the oil to the water was about 12.5:1. To facilitate transesterification, the reaction was conducted for about 72 hours at about 37°C in a shaking incubator. About 23 g of methanol was added in two stages: about 11.5 g (about 50%) was added after about 24 hours and a further 11.5 g (remaining 50%) was added after about 48 hours. Said methanol-to-oil ratio was about 6:1. Addition of the methanol in two stages ensures complete utilisation of the oil by the immobilised cells.
Grams of methanol= {6*32 (6 moles* molecular weight of methanol)/1* 830 (1 mole*molecular weight of oil)} * 100 (Grams of oil taken for transesterification) = 23.1 (~23g).
Engine Specification
Fuel blends (BD10 and BD20) and PBD were passed, through a fuel line, to observe performance characteristics and exhaust emissions. The specifications of a test engine were as follows:
Parameters Conditions
Cooling water-cooled
Stroke Four strokes
RPM 1,500
Power 3.75 kW
Compression Ratio 17:1
Stroke Length 110 mm
Bore 87.5 mm
Cubic Capacity 661 cc
Different engine loads (about 0%; about 25%; about 50%; about 75%; and about 100%) were tested. Exhaust gas analyses were performed, to determine emission characteristics. The engine's exhaust pipe was fitted with a K-type thermocouple to measure EGT. Additionally, a gas analyser was used to measure emissions of HC, NO, and CO. Furthermore, a smoke meter was used to measure amounts of smoke emissions.
Brake-Specific Fuel Consumption
As illustrated, in Figure 6, the fuel blends yielded results that were comparable with the results obtained when the PBD was tested.
Brake Thermal Efficiencies
As illustrated, in Figure 7, the fuel blends yielded results that were comparable with the results obtained when the PBD was tested.
Carbon Monoxide and Hydrocarbon Emissions
As illustrated, in Figure 8 and Figure 9, the fuel blends resulted in substantially lower CO and HC emissions.
 
NOx Emissions
As illustrated, in Figure 10, the fuel blends yielded results that were comparable with the results obtained when the PBD was tested.
Smoke Opacities
As illustrated, in Figure 11, when exposed to maximum engine loads, the fuel blends exhibited a similar smoke opacity as the PBD. However, at minimum engine loads, the fuel blends exhibited a significant decrease in the smoke opacity.
The disclosed biodiesel, fuel blend, and method of synthesis, offer at least the following synergistic advantages and effects: facilitate conversion of non-edible oil into value-added products; offer a high conversion of fatty acid methyl ester (about 90.2%); produce lower emissions when compared with those of conventional fuels; produce lower smoke opacities (or produce comparable smoke opacities), when compared with those of conventional fuels; and/or do not require any modifications, to be made to diesel engines.
It will be apparent to a person skilled in the art that the above description is for illustrative purposes only and should not be considered as limiting. Various modifications, additions, alterations, and improvements, without deviating from the spirit and the scope of the disclosure, may be made, by a person skilled in the art. Such modifications, additions, alterations, and improvements, should be construed as being within the scope of this disclosure.
, Claims:1. A method of synthesising biodiesel, comprising steps of:
immobilising cultured Enterobacter cloacae cells on a loofah sponge matrix by immersing said loofah sponge matrix in Zobell marine broth, incubating at 150 rpm, and maintaining at 37°C for 48 hours, to obtain 30% of Enterobacter cloacae cells that are immobilised on the loofah sponge matrix;
mixing the immobilised Enterobacter cloacae cells with Calophyllum inophyllum oil and water, with ratio of said Calophyllum inophyllum oil to said water being 12.5:1; and
performing transesterification with methanol at 37°C for 72 hours, with: ratio of said methanol to said oil being 6:1; 50% of said methanol being added after 24 hours; and remaining 50% of said methanol being added after 48 hours.
2. The method of synthesising biodiesel, as claimed in claim 1, wherein: weight of the single loofah sponge matrix is 0.458 g.
3. The method of synthesising biodiesel, as claimed in claim 1 or claim 2, wherein: 0.514 g of said Enterobacter cloacae cells are immobilised on said single piece of loofah sponge matrix.
4. The method of synthesising biodiesel, as claimed in claim 1, wherein: mass of said Calophyllum inophyllum oil is 100 g; and volume of said water is 8 mL.
5. The method of synthesising biodiesel, as claimed in claim 1, wherein: total weight of said methanol is 23 g.

6. The method of synthesising biodiesel, as claimed in claim 1, wherein: Enterobacter cloacae cells are immobilised on 58 loofah sponge matrices.

Documents